bbsi site Search Results


96
New England Biolabs bbsi site
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Bbsi Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bbsi site/product/New England Biolabs
Average 96 stars, based on 1 article reviews
bbsi site - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

96
New England Biolabs bbsi restriction sites
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Bbsi Restriction Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bbsi restriction sites/product/New England Biolabs
Average 96 stars, based on 1 article reviews
bbsi restriction sites - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

96
Addgene inc bbs i site into pspcas9 bb 2a puro
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Bbs I Site Into Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bbs i site into pspcas9 bb 2a puro/product/Addgene inc
Average 96 stars, based on 1 article reviews
bbs i site into pspcas9 bb 2a puro - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

96
Addgene inc bbsi site
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Bbsi Site, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bbsi site/product/Addgene inc
Average 96 stars, based on 1 article reviews
bbsi site - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

90
Cellecta Inc dox-inducible plasmid prsi16-puro at a unique bbsi site
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Dox Inducible Plasmid Prsi16 Puro At A Unique Bbsi Site, supplied by Cellecta Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dox-inducible plasmid prsi16-puro at a unique bbsi site/product/Cellecta Inc
Average 90 stars, based on 1 article reviews
dox-inducible plasmid prsi16-puro at a unique bbsi site - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

94
Addgene inc bbsi sites
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Bbsi Sites, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bbsi sites/product/Addgene inc
Average 94 stars, based on 1 article reviews
bbsi sites - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

90
Addgene inc espcas9(1.1) 71814
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Espcas9(1.1) 71814, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/espcas9(1.1) 71814/product/Addgene inc
Average 90 stars, based on 1 article reviews
espcas9(1.1) 71814 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Addgene inc cas9-t2a-egfp expression plasmid addgene plasmid #48140
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Cas9 T2a Egfp Expression Plasmid Addgene Plasmid #48140, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9-t2a-egfp expression plasmid addgene plasmid #48140/product/Addgene inc
Average 90 stars, based on 1 article reviews
cas9-t2a-egfp expression plasmid addgene plasmid #48140 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
GenScript corporation fncas9 bbsi sgrna cloning site
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Fncas9 Bbsi Sgrna Cloning Site, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fncas9 bbsi sgrna cloning site/product/GenScript corporation
Average 90 stars, based on 1 article reviews
fncas9 bbsi sgrna cloning site - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Addgene inc pspcas9(bb)-2a-puro (px459) v2.0
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Pspcas9(Bb) 2a Puro (Px459) V2.0, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pspcas9(bb)-2a-puro (px459) v2.0/product/Addgene inc
Average 90 stars, based on 1 article reviews
pspcas9(bb)-2a-puro (px459) v2.0 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
Addgene inc bbsi restriction site
Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , <t>POU5F1</t> , and <t>SOX2</t> . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)
Bbsi Restriction Site, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bbsi restriction site/product/Addgene inc
Average 93 stars, based on 1 article reviews
bbsi restriction site - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , POU5F1 , and SOX2 . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)

Journal: Cellular and Molecular Life Sciences

Article Title: DNA barcoding and gene expression recording reveal the presence of cancer cells with unique properties during tumor progression

doi: 10.1007/s00018-022-04640-4

Figure Lengend Snippet: Establishing DU145 cells with stem cell-related transcription factors expression-recording system. A Schematic diagram illustrating Cas9 cassette insertion immediately before the stop codon of NANOG , POU5F1 , and SOX2 . The Cas9 sequence was ligated to the gene with the T2A peptide sequence. The Cas9 cassette included Cas9, three repeated mClover3, delta thymidine kinase (∆TK), and PGK promoter-driven blasticidin S-resistant gene (BSD). Cas9 and mClover3 were separated at the 2A peptide sequence after translation. B The representative images of wild-type and DNA-barcoded Cas9-introduced DU145 cells. C The dot plot of mClover3 expression analyzed by flow cytometer. D The western blots of NANOG, POU5F1 (OCT3/4), SOX2, and Cas9-TY1 (H3, loading control). Proteins obtained from 1 or 2 × 10 5 cells were loaded in each lane (NT, non-treatment; DTX, docetaxel treatment; Sphere, sphere formation). E Schematic diagram illustrating the collection of DTX-resistant DU145 cells. F The line plot of cell proliferation of DNA-barcoded Cas9-introduced DU145 cells ( n = 3). G The line plot of the corrected barcode number in DNA-barcoded Cas9-introduced DU145 cells on days 0, 7, and 14 ( n = 3)

Article Snippet: pX330 (Addgene) was treated with BbsI (New England Biolabs), and DNA oligonucleotides comprising a gRNA sequence targeting the 3′ untranslated region (NANOG and SOX2) or downstream of the gene (POU5F1) were inserted into the BbsI site (NANOG: CCCATCCCTCATAGGATTTT, SOX2: GTACTGGCGAACCATCTCTG, and POU5F1: TTAAGGTCACACAACATCAG).

Techniques: Expressing, Sequencing, Flow Cytometry, Western Blot

Tracing a progeny of cells expressing stem cell transcription factors, including NANOG, POU5F1, and SOX2, in anticancer drug treatment or sphere formation. A – C Line plot depicting the percent mutation in stgRNA on days 0, 7, and 14 in NANOG-DU145 ( A ), POU5F1-DU145 ( B ), and SOX2-DU145 ( C ) cells. P value was calculated using Welch’s t -test with Bonferroni adjustment ( n = 3). D – F Heatmap representing the average score in each cell of top 10 cells with a high number of mutated reads from each sample in NANOG-DU145 ( n = 196 for #112; n = 176 for #128) ( D ), POU5F1-DU145 ( n = 195 for #112; n = 203 for # 114) ( E ), and SOX2-DU145 ( n = 152 for #98; n = 198 for #101) ( F ) cells. G Schema of the composition of cancer cells during tumor progression. H Schema of method- and cell-type-dependent variations in lung metastasis formation. I Schema of the lineage-specific or -stochastic expression of transcription factors. NT non-treatment, DTX docetaxel treatment; and Sphere sphere formation

Journal: Cellular and Molecular Life Sciences

Article Title: DNA barcoding and gene expression recording reveal the presence of cancer cells with unique properties during tumor progression

doi: 10.1007/s00018-022-04640-4

Figure Lengend Snippet: Tracing a progeny of cells expressing stem cell transcription factors, including NANOG, POU5F1, and SOX2, in anticancer drug treatment or sphere formation. A – C Line plot depicting the percent mutation in stgRNA on days 0, 7, and 14 in NANOG-DU145 ( A ), POU5F1-DU145 ( B ), and SOX2-DU145 ( C ) cells. P value was calculated using Welch’s t -test with Bonferroni adjustment ( n = 3). D – F Heatmap representing the average score in each cell of top 10 cells with a high number of mutated reads from each sample in NANOG-DU145 ( n = 196 for #112; n = 176 for #128) ( D ), POU5F1-DU145 ( n = 195 for #112; n = 203 for # 114) ( E ), and SOX2-DU145 ( n = 152 for #98; n = 198 for #101) ( F ) cells. G Schema of the composition of cancer cells during tumor progression. H Schema of method- and cell-type-dependent variations in lung metastasis formation. I Schema of the lineage-specific or -stochastic expression of transcription factors. NT non-treatment, DTX docetaxel treatment; and Sphere sphere formation

Article Snippet: pX330 (Addgene) was treated with BbsI (New England Biolabs), and DNA oligonucleotides comprising a gRNA sequence targeting the 3′ untranslated region (NANOG and SOX2) or downstream of the gene (POU5F1) were inserted into the BbsI site (NANOG: CCCATCCCTCATAGGATTTT, SOX2: GTACTGGCGAACCATCTCTG, and POU5F1: TTAAGGTCACACAACATCAG).

Techniques: Expressing, Mutagenesis